Potato Germplasm Enhancement Laboratory

Obihiro Univerisity of Agriculture and Veterinary Medicine
West 2-11, Inada, Obihiro, Hokkaido 080-8555, Japan

Rapid identification of potato cytoplasm types (Hosaka and Sanetomo 2012)

1. DNA extraction

Any DNA extraction method can be used. Here, FTA PlantSaver Card is used.

  1. Press plant tissue onto the card (FTA PlantSaver Card WB120065, Whatman). Allow to dry completely.

  2. Punch a 2.0 mm disk out of the FTA matrix impregnated with plant material using Harris Uni-core 2.0 mm Punch (WB100029, Whatman).

  3. Place the 2.0 mm disk in a 1.5 ml tube. Add 200 μl of FTA Purification Reagent, and leave for 5 min. Discard used reagent by a Pipetman.

  4. Add 200 μl of FTA Purification Reagent, and leave for 5 min. Discard used reagent by a Pipetman.

  5. Add 200 μl of isopropanol, and leave for 5 min. Discard used isopropanol by a Pipetman.

  6. Add 200 μl of isopropanol, and leave for 5 min. Discard used isopropanol by a Pipetman.

  7. Leave the lid open for several hours to dry the disk completely in a tube.

2. Multiplex PCR

  1. Drop a 2 mm dried disk into PCR tube, and then, dispense 5 μl each of the Reaction mix for FTA (or place 1 μl of DNA into the bottom of PCR tube, and then, dispense 4 μl each of Reaction mix).
    2. ComponentVolumeReaction mix (xn)Reaction mix for FTA (xn)
    DNA (5 ng/μl)1 μl--
    Dried FTA disk---
    2x Ampdirect Plus2.5 μl (1x)2.5 x n μl2.5 x n μl
    BIOTAQ HS DNA Polymerase (5 units/μl)0.025 μl (0.125 units)0.025 x n μl0.025 x n μl
    10x Primer mix0.5 μl0.5 x n μl0.5 x n μl
    Sterile water0.975 μl0.975 x n μl1.975 x n μl
    Total5 μl4 x n μl5 x n μl

    10x Primer mix
    MarkerPrimer (5' - 3' sequence)Conc. (μM)
    TGGAGGGGTTTTTCTTGGTTG
    AAGTTTACTCACGGCAATCG    		2
    SGGTTCGAATCCTTCCGTC
    GATTCTTTCGCATCTCGATTC    		2
    SACTTGGAGTTGTTGCGAATGAG
    GTTCCCTAGCCACGATTCTG    		2
    DCGGGAGGTGGTGTACTTTCT
    ACGGCTGACTGTGTGTTTGA    		3
    AAACTTTTTGAACTCTATTCCTTAATTG
    ACGCTTCATTAGCCCATACC    		3

  2. PCR [95°C 10 min, 35 cycles (94°C 30 sec, 60°C 30 sec, 72°C 1.5 min), 72°C 5 min, soak at 4°C]

3. BamHI digestion

  1. After PCR, add 5 μl of the following Digestion mix.
    ComponentVolumeDigestion mix (xn)
    10x NE Buffer 3 (New England Biolabs)1 μl1 x n μl
    100x BSA (10 mg/ml, New England Biolabs)0.1 μl0.1 x n μl
    BamHI (20 units/μl, New England Biolabs)0.3 μl (6 units)0.3 x n μl
    Sterile water3.6 μl3.6 x n μl
    Total5 μl5 x n μl

  2. Mix the reaction by vortexing and spin down. Incubate at 37°C for over 3 hr in a PCR machine.

or,

  1. After PCR, add 5 μl of the following Digestion mix.
    ComponentVolumeDigestion mix (xn)
    10x Fast Digest (Fermentas)1 μl1 x n μl
    FastDigest BamHI (10 units/μl, Fermentas)0.5 μl (5 units)0.5 x n μl
    Sterile water3.5 μl3.5 x n μl
    Total5 μl5 x n μl

  2. Mix the reaction by vortexing and spin down. Incubate at 37°C for over 5 min in a PCR machine.

4. Agarose gel electrophoresis

  1. Mix with 3 μl of PCR products loading dye (sterile water: 10x Dye = 17:13) (10x dye = 0.25% bromophenol blue, 0.25% xylene cyanol, and 25% Ficoll Type 400).

  2. Electrophoresis in a 3% agarose gel in 1x TBE buffer (89 mM Tris-borate, 89 mM boric acid, and 2 mM EDTA).

Note

  1. 2x Ampdirect Plus can be replaced by standard PCR buffer and dNTPs.

  2. BIOTAQ HS DNA Polymerase (5 units/μl) can be replaced by other Taq DNA polymerase (hot-start type is preferable).

  3. For extension at 72°C in PCR, 1.5 min is critical.

  4. Banding patterns of different cytoplasm types are shown on right.